If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Temporospatial Expression of Neuropeptide Substance P in Dental Pulp Stem Cells During Odontoblastic Differentiation in Vitro and Reparative Dentinogenesis in Vivo
Department of Operative Dentistry and Endodontology, College of Stomatology, Hospital of Stomatology, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Health Commission Key Laboratory of Prevention and Treatment for Oral Infectious Diseases, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Key Laboratory of Oral and Maxillofacial Rehabilitation and Reconstruction, Guangxi Clinical Research Center for Craniofacial Deformity, Nanning, Guangxi, China
Department of Operative Dentistry and Endodontology, College of Stomatology, Hospital of Stomatology, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Health Commission Key Laboratory of Prevention and Treatment for Oral Infectious Diseases, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Key Laboratory of Oral and Maxillofacial Rehabilitation and Reconstruction, Guangxi Clinical Research Center for Craniofacial Deformity, Nanning, Guangxi, China
Department of Operative Dentistry and Endodontology, College of Stomatology, Hospital of Stomatology, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Health Commission Key Laboratory of Prevention and Treatment for Oral Infectious Diseases, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Key Laboratory of Oral and Maxillofacial Rehabilitation and Reconstruction, Guangxi Clinical Research Center for Craniofacial Deformity, Nanning, Guangxi, China
Department of Operative Dentistry and Endodontology, College of Stomatology, Hospital of Stomatology, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Health Commission Key Laboratory of Prevention and Treatment for Oral Infectious Diseases, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Key Laboratory of Oral and Maxillofacial Rehabilitation and Reconstruction, Guangxi Clinical Research Center for Craniofacial Deformity, Nanning, Guangxi, China
Department of Operative Dentistry and Endodontology, College of Stomatology, Hospital of Stomatology, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Health Commission Key Laboratory of Prevention and Treatment for Oral Infectious Diseases, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Key Laboratory of Oral and Maxillofacial Rehabilitation and Reconstruction, Guangxi Clinical Research Center for Craniofacial Deformity, Nanning, Guangxi, China
Department of Operative Dentistry and Endodontology, College of Stomatology, Hospital of Stomatology, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Health Commission Key Laboratory of Prevention and Treatment for Oral Infectious Diseases, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Key Laboratory of Oral and Maxillofacial Rehabilitation and Reconstruction, Guangxi Clinical Research Center for Craniofacial Deformity, Nanning, Guangxi, China
Address requests for reprints to Dr Wen-Xia Chen, Department of Operative Dentistry and Endodontology, College of Stomatology, Hospital of Stomatology, Guangxi Medical University, No. 10 Shuangyong Road, Nanning, Guangxi, China 530021.
Department of Operative Dentistry and Endodontology, College of Stomatology, Hospital of Stomatology, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Health Commission Key Laboratory of Prevention and Treatment for Oral Infectious Diseases, Guangxi Medical University, Nanning, Guangxi, ChinaGuangxi Key Laboratory of Oral and Maxillofacial Rehabilitation and Reconstruction, Guangxi Clinical Research Center for Craniofacial Deformity, Nanning, Guangxi, China
Substance P (SP) is a neuropeptide released from the nervous fibers in response to injury. In addition to its association with pain and reactions to anxiety and stress, SP exerts various physiological functions by binding to the neurokinin-1 receptor (NK1R). However, the expression and role of SP in reparative dentinogenesis remain elusive. Here, we explored whether SP is involved in odontoblastic differentiation during reparative dentinogenesis.
Methods
Dental pulp stem cells (DPSCs) were isolated from healthy human dental pulp tissues and subjected to odontoblastic differentiation. The expression of SP and NK1R during odontoblastic differentiation was investigated in vitro. The effects of SP on odontoblastic differentiation of DPSCs were evaluated using alizarin red staining, alkaline phosphatase staining, and real-time polymerase chain reaction. After direct pulp capping with mineral trioxide aggregate, the expression of SP and NK1R during reparative dentin formation in rats were identified using histological and immunohistochemical staining.
Results
SP and NK1R expression increased during the odontoblastic differentiation of DPSCs. SP translocated to the nucleus when DPSCs were exposed to differentiation medium. NK1R was always present in the nuclei of DPSCs and odontoblast-like cells. Additionally, we discovered that 10−8 M SP marginally enhanced the odontoblastic differentiation of DPSCs, and that these effects could be impaired by the NK1R antagonist. Furthermore, SP and NK1R were expressed in odontoblast-like and dental pulp cells during reparative dentin formation in vivo.
Conclusions
SP contributes to odontoblastic differentiation during reparative dentin formation by binding to the NK1R.
This research revealed the expression of SP and NK1R in odontoblastic differentiation of DPSCs both in vitro and vivo explored a correlation between SP/NK1R and reparative dentin formation, which improve our understanding of the role of neuropeptide in dental repair.
Reparative dentin is a reconstitution of the tissue architecture at the injury site and plays a crucial role in preserving pulp vitality. The process of reparative dentinogenesis begins with the differentiation of odontoblasts from dental pulp stem cells (DPSCs) and subsequent maturation and mineralization of the extracellular matrix
. DPSCs differentiation is essential for the process of reparative dentinogenesis. To date, various types of molecules have been implicated in this complicated dynamic process
. Therefore, understanding the molecular mechanisms involved in DPSCs differentiation will help develop strategies to treat dental pulp injury.
Dental pulp is highly innervated by sympathetic and sensory nerve fibers containing neuropeptides. Neuropeptides released from primary afferent neurons play an important role in triggering inflammation of neural origin. Inflammatory events may contribute to the very early phases of pulp repair, especially if there is a direct link between the release of cytokines and the odontoblastic differentiation of DPSCs. Substance P (SP), an 11 amino acid peptide, was the first endogenous neuropeptide identified in dental tissues
. Over the past few years, there has been an increasing interest in understanding the interaction between SP and tissue regeneration. SP was recently shown to enhance bone mesenchymal stem cells (BMSCs) proliferation, migration, and osteogenic differentiation in vitro, and it plays a paramount role in modulating bone remodeling
. Nevertheless, the function of SP in reparative dentin formation is not well established.
Furthermore, temporospatial expression of SP and NK1R during reparative dentin formation is yet to be reported. As dentin is a living connective tissue with biomechanical properties similar to bone and SP is associated with the osteogenesis of bone tissue, we postulate that SP may regulate the odontoblastic differentiation of DPSCs during reparative dentinogenesis. Therefore, the aim of the current study was to investigate the expression patterns of SP and NK1R during the differentiation of DPSCs, in vitro and in vivo and the effects of SP/NK1R signaling on odontoblastic differentiation of DPSCs.
Materials and Methods
Cell Culture and Identification of Dental Pulp Stem Cells
The study was approved by the Ethics Committee of Guangxi Medical University, Nanning, Guangxi, China. DPSCs were isolated from healthy human dental pulp tissue using a previously published method
Static magnetic fields enhance dental pulp stem cell proliferation by activating the p38 mitogen-activated protein kinase pathway as its putative mechanism.
. The third or fourth passage cells were used in subsequent experiments.
Multipotential differentiation and surface markers were used to identify DPSCs. We determined the multipotential differentiation of DPSCs into osteoblasts and adipocytes in vitro. DPSCs were induced for 21 days in osteogenesis and adipogenesis induction media (Cyagen, Guangzhou, China) according to the manufacturer's instructions and subsequently stained with alizarin red S (ARS) and oil red O (Cyagen, Guangzhou, China), respectively. Phenotyping of DPSCs was performed using flow cytometry and an MSC Phenotyping Kit (BD Pharmingen, San Diego, CA, USA) containing the necessary antibodies and fluorophores. The fluorescent-conjugated antibodies used were anti-CD34-PE, anti-CD45-FITC, anti-CD90-PerCP-Cy5.5, and anti-CD29-APC.
Cell Treatment
DPSCs were seeded in a 6-well plate at 2 × 105 cells/well or in a 48-well plate at 2 × 104 cells/well in growth medium (GM) containing Dulbecco's Modified Eagle Medium (Hyclone) with 10% fetal bovine serum (Zata Life) and 100 U/mL of penicillin/streptomycin (Hyclone). After reaching 80%–90% confluence, cells were cultured in osteogenesis/odontoblastic differentiation medium (DM) (Cyagen, Guangzhou, China ) according to the manufacturer's instructions.
To explore the dose-dependent effects of SP, the cells were continuously stimulated with SP (MedChemExpress, Jersey, USA) at concentrations of 10−10, 10−8, 10−6, or 10−5 M for 7, 14, and 21 days. To determine the role of SP/NK1R signaling in odontoblastic differentiation of DPSCs, cells were cultured in DM with either 10−8 M SP or 25 μM aprepitant (Apr, NK1R antagonist; MedChemExpress, Jersey, USA) for 7, 14, and 21 days. The culture medium was refreshed every 3 days, and fresh SP or aprepitant was added when the medium was changed.
Alizarin Red Staining and Alkaline Phosphatase Staining
The formation of mineralized nodules and alkaline phosphatase (ALP) activity of DPSCs were detected using ARS (Cyagen, Guangzhou, China) and the 5-bromo-4-chloro-3-inodlyl-phosphate/nnitro-lue-etrazolium ALP kit (Nanjing Jiancheng Bioengineering Institute, China), respectively, as suggested by the manufacturer. Briefly, cells were fixed in 4% paraformaldehyde for 30 minutes and washed thrice with phosphate-buffered saline. The cells were subsequently stained with ARS and tris-buffered staining solution containing 5-bromo-4-chloro-3-inodlyl-phosphate/nnitro-lue-etrazolium for 10–30 minutes. Images were acquired using a microscope scanner (Nikon, Tokyo, Japan).
Real-time Polymerase Chain Reaction (RT-PCR)
Total RNA was extracted using TRIzol reagent (Genstar, Beijing, China). Thereafter, 1 μg of total RNA was synthesized into complementary DNA using a PrimeScript RT reagent Kit (TaKaRa, Shiga, Japan). RT-PCR was performed with 2 × RealStar Power SYBR qPCR Mix (Genstar, Beijing, China), and glyceraldehyde-3-phosphate dehydrogenase served as an internal control. Primer sequences used in this study are listed in Table 1.
Table 1List of Primer Sequences Used in This Study
Genes
Primer forward
Primer reverse
SP
ACAAGTGGCCCTGTTAAAGGCT
GCACTCCTTTCATAAGCCACAGAAT
NK1R
TCTACTTCCTCCCCCTGCTG
CATTTTGACCACCTTGCGCT
ALP
AACATCAGGGACATTGACGTG
GTATCTCGGTTTGAAGCTCTTCC
COL I
CGATGGATTCCAGTTCGAG
TAGGTGATGTTCTGGGAGGC
DSPP
GATAGCAGTGACGGCAGTGATAGC
GCTAYYGCTGCTTTCGTTGCTGTC
RUNX2
GTCCACACCATTAGGGACCATC
GCTAATGCTTCGTGTTTCCATGTA
GAPDH
CAAAGCGCTCCCCTTTAGAGGT
CAAATTCCATGGCACCGTCA
ALP, alkaline phosphatase; COL I, collagen I; DSPP, dentin sialophosphoprotein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NK1R, neurokinin-1 receptor; RUNX2, runt-related transcription factor 2; SP, Substance P.
ELISA was used to quantify the protein levels of SP in DPSCs during odontoblastic differentiation. The conditioned medium (CM) was collected on days 0, 7, 14, and 21 and stored at –80°C before analysis. SP levels in the CM were determined using an ELISA kit (MEIMIAN, Jiangsu, China), according to the manufacturer's instructions.
Western Blot Analysis
Total cellular proteins of DPSCs on days 0, 7, 14, and 21 were isolated using a total protein extraction kit (KeyGene, China). After quantification using the BCA protein assay kit (Beyotime Biotechnology, Jiangsu, China), the lysates were electrophoresed on sodium dodecyl sulfate-polyacrylamide gels and transferred to membranes. Membranes were incubated with anti-NK1R (1:1000; Bioworld Technology, Inc, USA) overnight at 4°C. After incubation with the secondary antibody (Abmart, Shanghai, China) for 1 hour, protein bands were visualized using a western blot analysis imaging system (Bio-Rad, Hercules, CA, USA).
Immunofluorescence Staining
The DPSCs were cultured with GM or osteogenesis/odontoblastic DM on a laser confocal dish for 3 days. After washing and fixing, the cells were permeabilized with 0.25% Triton X-100, blocked with blocking reagent (Bioworld Technology, Inc, USA) and incubated with rabbit-derived anti-substance P (1:200; Bioworld Technology, Inc, USA) or rabbit anti-NK1R (1:100; Bioworld Technology, Inc, USA) overnight at 4°C. Thereafter, the cells were incubated with anti-rabbit lgG-FITC (1:100; Bioworld) for 1 hour at 37°C and counterstained with DAPI to reveal the nuclei. Immunostained cells were visualized under a confocal microscope (Olympus FV3000, Tokyo, Japan).
Induction of Reparative Dentin Formation and Sample Preparation
Adult male Sprague-Dawley rats weighing 220–250 g were used in this study. A total of 25 rats were divided into 5groups according to the observation period (normal, 0, 7, 14, and, 21 days, n = 5 rats for each time point, 2 teeth per rat). The animals were anesthetized with 10% chloral hydrate injected intraperitoneally at a dose of 3 ml/kg. After cleaning and disinfection with cotton soaked in 75% ethanol, a no. 1/4 round bur was used to create a class V cavity with a standardized diameter of 1 mm and depth on the mesial surface of the maxillary first molar of each rat without pulp exposure. Pulp perforation was performed using #15 sterile K-file. The cavity was sealed with mineral trioxide aggregate (MTA) (ProRoot MTA; Dentsply Sirona, York, PA, USA) after controlling the bleeding with sterile cotton pellets. Thereafter, a 1-step bonding agent (Filtek Z350XT, 3M ESPE, St. Paul, MN, USA) was applied to the tooth according to the manufacturer's instructions, and the cavity was filled with a flowable resin composite (Filtek Z350XT). Relief of the opposing cusp tips after restoration was performed to minimize occlusal forces.
The maxillary segments were retrieved and soaked in 10% neutral buffered formalin for 24 hours. After demineralization with 13.7% sterilized ethylenediaminetetraacetic acid, the samples were dehydrated using a graded series of alcohol and embedded in paraffin. Hematoxylin-eosin (H&E) staining and immunohistochemistry were performed on serial sections with a thickness of 4 μm.
H&E Staining and Immunohistochemistry
H&E staining was performed according to conventional pathological protocols. Inflammation and reparative dentin formation in each sample were observed and imaged under a light microscope (Nikon, Tokyo, Japan). For immunohistochemistry, tissue sections were deparaffinized and antigen retrieval was performed using pepsin (Zhongshan, Beijing, China) for 10 minutes. Endogenous peroxidase activity was deactivated by incubation for 7 minutes with 3% H2O2. Thereafter, the sections were incubated overnight at 4°C with primary antibodies, polyclonal rabbit anti-SP (1:400; Bioworld Technology, Inc, USA), and polyclonal rabbit anti-tachykinin receptor 1 (1:200; Abmart, Shanghai, China). After staining with the PV-6000 kit (Zhongshan, Beijing, China) according to the manufacturer's instructions, positive reactions were visualized using a simple DAB stain solution. The samples were counterstained with hematoxylin and observed under a light microscope.
Statistical Analyses
The expression of mineralization-related indicators, SP and NK1R, is presented as the mean ± standard deviation. Statistical analyses were conducted using 1-way analysis of variance and an independent samples t-test using GraphPad Prism v7.0 software (GraphPad Software Inc, San Diego, CA, USA). P < .05 was considered statistically significant.
Results
Isolation and Characterization of DPSCs
Spindle-shaped fibroblast-like morphology was observed in first-to third-passage DPSCs (Fig. 1A). The differentiation of DPSCs was demonstrated as red mineralized nodules with ARS and as red oil drops using oil red O staining (Fig. 1A). Flow cytometry analysis revealed that the cells showed positive expression of mesenchymal stem cell markers CD29 (100%) and CD90 (95.6%) and negative staining for hematopoietic cell-specific markers CD34 (0.11%) and CD45 (0.13%) (Fig. 1B), indicating their mesenchymal origin.
Figure 1Identification and mineralization ability of DPSCs in vitro. (A) The morphology of DPSCs at the primary (magnification, ×100) and third passages (magnification ×40) was observed under a microscope. The differentiation of DPSCs was demonstrated as red mineralized nodules using ARS, (magnification, ×40) and red oil drops using oil red O staining (magnification, ×40). (B) Surface markers (CD29, CD90, CD34, CD45) of DPSCs were detected using the flow cytometry assay. (C) ARS and ALP staining were measured on days 7, 14, and, 21 after mineralization induction. (D) mRNA expression of mineralized genes (ALP, COL I, DSPP, and RUNX2) on days 7, 14, and 21 after mineralization induction. ∗P < .05 compared with 0 d. DPSCs, Dental pulp stem cells; ARS, Alizarin red Stain; ALP, Alkaline phosphate; COL I, Collagen I; DSPP, dentin sialophosphoprotein; RUNX2, Runt-related transcription factor 2.
To determine the differentiation potential of DPSCs into odontoblasts/osteoblasts, DPSCs were cultured with DM for 7, 14, and 21 days. The mineralized nodules were observed on day 7 and slowly increased over the subsequent days in the induced group, whereas no mineral deposits were observed in the control group (Fig. 1C). ALP activity was detected using ALP staining, which also showed a time-dependent up regulation after mineralized induction compared with the control group (Fig. 1C). In addition, the results of RT-PCR showed that ALP, dentin sialophosphoprotein (DSPP), and runt-related transcription factor 2 (RUNX2) mRNA expression increased over time (P < .05) (Fig. 1D). The expression of collagen I (COL I) peaked on day 14 and subsequently declined when compared with that on day 0 (P < .05) (Fig. 1D).
SP and NK1R Expressed in an Increased Tendency during Odontoblastic Differentiation
To determine the role of SP/NK1R in odontoblastic differentiation of DPSCs, SP, NK1R mRNA, and protein levels were examined. RT-PCR analysis revealed an increase in SP and NK1R mRNA expression over time during mineralization induction (P < .05) (Fig. 2A and B). Consistently, the protein level of SP detected in the CM increased significantly after odontoblastic differentiation, reaching its peak on day 14 (P < .05) (Fig. 2C). In addition, NK1R expression increased stepwise during odontoblastic differentiation (Fig. 2D). The presence and localization of SP and NK1R were also tested using immunofluorescence. Immunofluorescence analysis showed that SP was distributed in both the cytoplasm and nuclei of undifferentiated DPSCs. Notably, SP translocated to the nuclei after DPSCs were cultured in DM for 3 days (Fig. 2E). However, NK1R immunoreactivity of DPSCs in both GM and DM was primarily observed in the nuclei (Fig. 2F).
Figure 2Expression of SP and NK1R during odontoblastic differentiation. (A and B) mRNA expression of SP and NK1R during odontoblastic differentiation was examined using real-time polymerase chain reaction. (C) The protein level of SP during odontoblastic differentiation was detected using ELISA. (D) Expression of NK1R protein during odontoblastic differentiation was determined using western blot analysis. (E and F) Immunofluorescence localization of SP and NK1R in DPSCs cultured with DM for 0 and 3 days. Scale bar = 20 μm. Data are presented as the mean ± standard deviation. ∗P < .05 compared with 0 days. SP, Substance P; NK1R, Nuerokinin-1 receptor; DPSCs, Dental pulp stem cells; DM, differentiation medium.
Effects of SP on DPSCs Differentiation at Different Concentrations
To evaluate how SP affects the differentiation of DPSCs at different concentrations, we incubated DPSCs in DM with SP at concentrations of 10−10, 10−8, 10−6, or 10−5 M for 7, 14, and 21 days. Compared to the control group, ARS and ALP staining showed that the formation of mineralized nodules and ALP activity were increased in the low concentrations of SP (10−10–10−6 M) group, and was significantly reduced in the 10−5 M SP group (Fig. 3A). Furthermore, the mRNA expression of odontoblast-related genes, including ALP, COL Ⅰ, DSPP, and RUXN2, was examined. SP (10−8 M and 10−10 M) significantly increased the levels of ALP, COL I, and RUXN2 on days 7 and 14 (P < .05) (Fig. 3B, C, and E). Stimulation with 10−6 M SP resulted in elevated mRNA levels of ALP, COL Ⅰ, and RUXN2 on day 14 compared to those in the control group (P < .05) (Fig. 3B, C, and E). However, 10−5 M SP significantly downregulated the levels of ALP on days 7 and 14 (P < .05) (Fig. 3B) and DSPP on day 14 (P < .05) (Fig. 3D).
Figure 3The impact of SP/NK1R signaling on DPSC odontogenesis. (A) ARS on day 21 and ALP staining on day 14 of DPSCs cultured in GM, or GM with SP at concentrations of 10−10, 10−8, 10−6, or 10−5 M. (B–E) Expression levels of odontogenic genes (ALP, COL I, DSPP, and RUNX2) were measured using RT-PCR on days 7 and 14 of each culture condition. Data are presented as the mean ± standard deviation. ∗P < .05 compared with the control. (F) ARS on day 21 and ALP staining on day 14 of DPSCs treated with either 10−8 M SP or aprepitant. (G–J) mRNA levels of ALP, COL I, DSPP, and RUNX2 in DPSCs treated with either 10−8 M SP or aprepitant were measured on day 7. Data are presented as the mean ± standard deviation. ∗P < .05 compared with SP. SP, Substance P; NK1R, Nuerokinin-1 receptor; DPSCs, Dental pulp stem cells; DM, differentiation medium; GM, Growth medium; ARS, Alizarin red Stain; ALP, Alkaline phosphate; COL I, Collagen I; DSPP, dentin sialophosphoprotein; RUNX2, Runt-related transcription factor 2 RT-PCR, Real-time Polymerase Chain Reaction.
Inhibition of SP/NK1R Signaling Impairs Odontoblastic Differentiation of DPSCs
To elucidate whether the effect of SP on DPSCs differentiation was mediated by its receptor interactions, DPSCs were treated with either 10−8 M SP or an NK1R antagonist (Apr). ARS and ALP staining showed that 10−8 M SP marginally elevated the formation of mineralized nodules and ALP activity compared with the control group (Fig. 3F). Treatment with SP (10−8 M) also significantly increased the expression of ALP, COL Ⅰ, DSPP, and RUXN2. This effect was significantly inhibited by addition of the NK1R antagonist (P < .05) (Fig. 3G–J).
An Elevated Expression of SP and NK1R Was Demonstrated during Reparative Dentin Formation
To observe the expression pattern of SP and NK1R during reparative dentin formation, H&E staining and immunohistochemistry were performed in dental pulps at different stages of the reparative process. The histological structures on day 0 (Fig. 4B and B1) were similar to those in the normal group (Fig. 4A and A1), with no reparative dentin or inflammatory cells. Low SP expression levels were observed in the cytoplasm and matrix of dental pulp cells (Fig. 4A2 and B2). NK1R expression was primarily observed in the nuclei of odontoblasts and pulp fibroblasts (Fig. 4A2 and B2). On day 7, necrotic or amorphous layers were observed on the exposed side of the pulp, with few inflammatory infiltrations. Notably, little reparative dentin was observed near the perforation site (Fig. 4C and C1). At this stage, SP-immunoreactive fibers were brownish-yellow lines and primarily distributed around or with blood vessels, a few nerve fibers were distributed under the odontoblast layer, and high coloring was observed in the cytoplasm and matrix of dental pulp cells (Fig. 4C2). High levels of NK1R expression were observed in odontoblasts, odontoblast-like cells, endothelial cells, mesenchymal stem cells, and the uncalcified reparative dentin matrix underneath perforation sites (Fig. 4C3).
Figure 4Temporospatial expression of SP and NK1R during reparative dentin formation. H&E staining of maxillary sections at normal pulp (A and A1), day 0 (B and B1), day 7 (C and C1), day 14 (D and D1), and day 21 (E and E1) after pulp capping. SP expression was detected using immunohistochemistry at normal pulp (A2), 0 (B2), 7 (C2), 14 (D2), and 21 (E2) d after pulp capping. NK1R expression was detected using immunohistochemistry at normal pulp (A3), 0 (B3), 7 (C3), 14 (D3), and 21 (E3) days after pulp capping. (A1, B1, C1, D1, and E1) Higher magnification images of black boxes in (A, B, C, D, and E). (A1–A3, B1–B3) Arrowheads indicate odontoblasts that line the inner surface of the dentin. (C1–C3, D1–D3, and E1–E3) Arrows indicate columnar odontoblast-like cells lined along the inner surface of reparative dentin (Rd). De, dentin; Rd, reparative dentin. Scale bar of A, B, C, D, and E = 500 μm. Scale bar of A1–A3, B1–B3, C1–C3, D1–D3, and E1–E3 = 25 μm. SP, Substance P; NK1R, Nuerokinin-1 receptor; H&E, Hematoxilin-eosin.
On day 14, around the perforation, more dentin bridge-like calcified tissues were present, with some entrapped or surrounding odontoblast-like cells, inflammatory cells, and capillaries (Fig. 4D and D1). At this stage, SP and NK1R were expressed at a higher intensity in odontoblast-like cells lining the reparative dentin and some dental pulp cells underneath the exposure site than those at 0 days (Fig. 4D2 and D3). On day 21, the perforation was sealed with several delicate tube-like structures of eosinophilic dentin bridges lined with odontoblasts (Fig. 4E and E1). There was a high level of SP and NK1R expression in odontoblast-like cells and pulp cells in reparative dentin (Fig. 4E2 and E3).
Discussion
The results reported here demonstrated that DPSCs can secrete SP and express its receptor NK1R and that SP can regulate odontoblastic differentiation of DPSCs in a concentration-dependent manner. Furthermore, it is noteworthy to observe complete inhibition of SP-induced mineralization with pretreatment of the NK1R antagonist as it suggests that inhibition of SP/NK1R signaling led to a downregulation of mineralization. The most noteworthy finding of this study was the subcellular localization (in both the cytoplasm and nucleus) of SP and NK1R in DPSCs, which provided considerable insight into the mechanism underlying their role in dental repair.
DPSCs undergo odontoblastic differentiation in response to tooth injury as a crucial step in the reparative dentin formation process
. Previous studies have suggested that DPSCs can differentiate into odontoblast-like cells by mineralization induction, resulting in dentin-like structures lined by odontoblast-like cells
. In our study, mineralized nodules, ALP activity, and the expression of ALP, COL I, DSPP, and RUXN2 were upregulated in DPSCs during mineralization induction, indicating that DPSCs differentiated into odontoblast-like cells after DM treatment.
Research has shown that MTA promotes more and thicker reparative dentin than conventional materials
. Therefore, this study utilized MTA as a direct pulp capping material to evaluate the pathophysiology of pulp repair. Consistent with previous studies
Quantitative determination of high-temperature requirement protein A1 and its possible associated molecules during induced reparative dentin formation.
, reparative dentin formation beneath the perforation was observed on day 7, followed by further increases on days 14 and 21. After pulp capping, the reparative dentin that formed beneath the perforation allowed us to determine the spatiotemporal expression of SP and NK1R.
It has been reported that sensory nerve fibers modulate bone and cartilage metabolism and tissue healing via SP/NK1R signaling
. Although SP and its receptors are widely distributed in bone tissue, no conclusive results have demonstrated the expression and function of SP/NK1R in dental pulp cells and during reparative dentin formation. In this study, our analysis revealed that SP and NK1R expression was upregulated in odontoblast-like cells throughout mineralization induction in vitro. Additionally, the overall upregulation in SP and NK1R expression found in odontoblast-like cells and dental pulp cells beneath the perforation sites in the present study is consistent with the SP increases described in other models of inflammation and regeneration. Therefore, SP may modulate dentin metabolism during the differentiation and maturation of DPSCs by activating NK1R. The regulatory mechanisms underlying this upregulation of SP expression during dental pulp repair may include (1) a concomitant increase in synthesis and transport in the trigeminal ganglia, (2) increased release of SP from primary afferent interdental neurons, and (3) decreased degradation of SP
. However, a deeper understanding of the mechanisms underlying SP expression requires further study.
The abundance of SP-immunoreactive sensory neurons, together with the upregulation of SP during pulpal injury, have gained attention as a function of this peptide in dental tissues. However, the specific effects of SP on dental pulp repair are poorly understood. The effects of SP on mineralization have been reported by previous researchers with conflicting results. Hence, SP may have a variety of functions depending on its concentration, type, and the state of tissue or cell. According to previous studies, SP treatment at higher concentrations (in the range of 10−8–10−6 M) stimulated BMSCs mineralization in a concentration-dependent manner
. Similarly, Goto et al found that SP treatment of calvarial osteoblasts increases the number and size of bone colonies and bone-related protein expression
Substance P promotes the proliferation, but inhibits differentiation and mineralization of osteoblasts from rats with spinal cord injury via RANKL/OPG system.
. In this study, SP hadvarious effects on DPSCs differentiation at different concentrations, with 10−8 M SP having the strongest stimulation effect. Our results concur with those of a study by Wang et al, who reported that SP stimulated bone nodule formation in a dose-dependent manner, with a maximal effect at the 10−8 M concentration
. Therefore, SP may promote mineralization when a specific concentration of SP (perhaps 10−8 M) is maintained in a limited area. Additionally, we found that SP treatment was entirely inhibited by NK1R antagonist. These findings indicated that SP-mediated DPSC mineralization effects are NK1R mediated.
The localization of a peptide and its receptor affects the function of the cellular compartment in which they reside. To the best of our knowledge, this is the first report on the subcellular localization of both SP and NK1R in DPSCs, which could offer insights into their autocrine and paracrine mechanisms. The expression of SP in the cytoplasm of DPSCs indicates that SP is released and exerts autocrine, paracrine, and endocrine actions. Notably, SP translocated to the nuclei after exposure to DM, indicates that SP may act as an epigenetic factor, regulating the gene expression of DPSCs. Furthermore, our results revealed that DPSCs had higher nuclear localization of NK1R than cytoplasmic localization. This suggests that NK1R can respond to SP during DPSCs differentiation. These findings are in accordance with the high expression of NK1R within the nuclei of adipose tissue stem cells
. Taken together, the presence of SP and NK1R in the nucleus/cytoplasm of DPSCs indicated that the SP peptide could modulate the nuclear activity of DPSCs through NK1R.
Inconclusion, the expression of SP and NK1R in odontoblastic differentiation of DPSCs in vitro and during experimental reparative dentin formation in vivo was evaluated in the present study. The results of our study demonstrate that SP/NK1R signaling plays a critical role in regulating reparative dentin formation. These findings provide new insights into the regulating ability of SP involved in dental pulp repair, which may provide the basis for a potential new clinical treatment strategy. However, the mechanism by which SP/NK1R signaling regulates DPSCs differentiation and the mechanisms involved in reparative dentin formation remain elusive. More studies are warranted to identify the detailed mechanisms of SP in odontoblastic differentiation of DPSCs, and further studies are required to investigate the role of SP/NK1R signaling in animal models of dentin repair.
Acknowledgments
Xiao-Lang Wei and Ling Luo contributed equally to the study.
This work was supported by grants from the Innovation Project of Guangxi Graduate Education (grant no. YCBZ2020055).
The authors deny any conflicts of interest related to this study.
References
Goldberg M.
Smith A.J.
Cells and extracellular matrices of dentin and pulp: a biological basis for repair and tissue engineering.
Static magnetic fields enhance dental pulp stem cell proliferation by activating the p38 mitogen-activated protein kinase pathway as its putative mechanism.
Quantitative determination of high-temperature requirement protein A1 and its possible associated molecules during induced reparative dentin formation.
Substance P promotes the proliferation, but inhibits differentiation and mineralization of osteoblasts from rats with spinal cord injury via RANKL/OPG system.
00844-5&id=gr1.jpg){kind=link}
00844-5&id=gr2.jpg){kind=link}
00844-5&id=gr3.jpg){kind=link}
00844-5&id=gr4.jpg){kind=link}